Transcript: Mouse NM_001033298.3

Mus musculus kizuna centrosomal protein (Kiz), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Kiz (228730)
Length:
2150
CDS:
34..2121

Additional Resources:

NCBI RefSeq record:
NM_001033298.3
NBCI Gene record:
Kiz (228730)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033298.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252521 CTCGTTACAGGAAAGATTAAG pLKO_005 885 CDS 100% 13.200 18.480 N Kiz n/a
2 TRCN0000252518 GTGACCATAGGTCAGCTATTC pLKO_005 1532 CDS 100% 10.800 15.120 N Kiz n/a
3 TRCN0000252522 ATCAACCAGCAACAATCTTTA pLKO_005 515 CDS 100% 13.200 9.240 N Kiz n/a
4 TRCN0000252519 GATTCGCTCTTCACGGAATAT pLKO_005 1330 CDS 100% 13.200 9.240 N Kiz n/a
5 TRCN0000252520 CTTGCAGCATGCCATCTATTC pLKO_005 1568 CDS 100% 10.800 7.560 N Kiz n/a
6 TRCN0000133823 CAAGGGAACAAGAAGTTTCAA pLKO.1 1649 CDS 100% 5.625 3.938 N KIZ n/a
7 TRCN0000134625 GATTGTATCAACCAGCAACAA pLKO.1 509 CDS 100% 4.950 3.465 N KIZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033298.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.