Transcript: Mouse NM_001033300.2

Mus musculus guanine monophosphate synthetase (Gmps), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Gmps (229363)
Length:
4567
CDS:
142..2223

Additional Resources:

NCBI RefSeq record:
NM_001033300.2
NBCI Gene record:
Gmps (229363)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033300.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045940 GCCTGGCAATCAGAGTAATAT pLKO.1 1466 CDS 100% 15.000 21.000 N GMPS n/a
2 TRCN0000251163 ATGCCATAGAAAGGTATAATA pLKO_005 2655 3UTR 100% 15.000 10.500 N Gmps n/a
3 TRCN0000230039 ATGTGCTGAAGAACCTTATAT pLKO_005 1485 CDS 100% 15.000 10.500 N GMPS n/a
4 TRCN0000251160 ATGTGCTGAAGAACCTTATAT pLKO_005 1485 CDS 100% 15.000 10.500 N Gmps n/a
5 TRCN0000045938 CCTGGTTTGATCCAGCAATAT pLKO.1 401 CDS 100% 13.200 9.240 N GMPS n/a
6 TRCN0000251162 GAATGCTGGAGGAGATCTTAA pLKO_005 174 CDS 100% 13.200 9.240 N Gmps n/a
7 TRCN0000251161 ACAAGGATTTCGGGCTATTAT pLKO_005 339 CDS 100% 15.000 9.000 N Gmps n/a
8 TRCN0000230038 ACTTTACGGCCTGATCTAATT pLKO_005 1243 CDS 100% 13.200 18.480 N GMPS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033300.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.