Transcript: Mouse NM_001033301.4

Mus musculus FH2 domain containing 1 (Fhdc1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Fhdc1 (229474)
Length:
5930
CDS:
210..3659

Additional Resources:

NCBI RefSeq record:
NM_001033301.4
NBCI Gene record:
Fhdc1 (229474)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033301.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293103 CCGGCAATGCCGTAGGATTTA pLKO_005 1144 CDS 100% 13.200 18.480 N Fhdc1 n/a
2 TRCN0000217834 CCATCGTAGAGGATATCTATC pLKO.1 784 CDS 100% 10.800 15.120 N Fhdc1 n/a
3 TRCN0000116245 GCCAAACTATTCACTTCGGAT pLKO.1 956 CDS 100% 2.640 3.696 N FHDC1 n/a
4 TRCN0000293106 AGTATGAACATTGGCATATTT pLKO_005 735 CDS 100% 15.000 12.000 N Fhdc1 n/a
5 TRCN0000293105 CTTAAAGGTCACGTCACTAAA pLKO_005 3785 3UTR 100% 13.200 9.240 N Fhdc1 n/a
6 TRCN0000293104 GTGCAAGAGACATCGAGATTA pLKO_005 1296 CDS 100% 13.200 9.240 N Fhdc1 n/a
7 TRCN0000183851 CCAGTCTTAAACATCTTGTTA pLKO.1 3735 3UTR 100% 5.625 3.938 N Fhdc1 n/a
8 TRCN0000181122 CCAACTGACTCTGAATGACTT pLKO.1 2276 CDS 100% 4.950 3.465 N Fhdc1 n/a
9 TRCN0000178979 CCTTCTAAACTTCTCTGAGAA pLKO.1 1265 CDS 100% 4.950 3.465 N Fhdc1 n/a
10 TRCN0000179970 CGAAATCAAAGCTGAGAGTAT pLKO.1 3847 3UTR 100% 4.950 3.465 N Fhdc1 n/a
11 TRCN0000179013 CTGGAATGAATCTTCTGCATT pLKO.1 1210 CDS 100% 4.950 3.465 N Fhdc1 n/a
12 TRCN0000293102 CTGGAATGAATCTTCTGCATT pLKO_005 1210 CDS 100% 4.950 3.465 N Fhdc1 n/a
13 TRCN0000179218 GCCAGTCTTAAACATCTTGTT pLKO.1 3734 3UTR 100% 4.950 3.465 N Fhdc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033301.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.