Transcript: Mouse NM_001033379.3

Mus musculus decapping mRNA 1B (Dcp1b), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dcp1b (319618)
Length:
3311
CDS:
41..1777

Additional Resources:

NCBI RefSeq record:
NM_001033379.3
NBCI Gene record:
Dcp1b (319618)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033379.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226168 ACGGCACACTGTCCATTTATG pLKO_005 351 CDS 100% 13.200 18.480 N Dcp1b n/a
2 TRCN0000376377 AGGTCATGTAAGGTTCGATTT pLKO_005 2002 3UTR 100% 10.800 15.120 N Dcp1b n/a
3 TRCN0000376315 GGAGGTTCTCAGAGCTATTTA pLKO_005 2074 3UTR 100% 15.000 10.500 N Dcp1b n/a
4 TRCN0000219044 AGAACAGAACCCATTACTAAA pLKO_005 287 CDS 100% 13.200 9.240 N Dcp1b n/a
5 TRCN0000226170 CCCAATCACAGCTGGTGTATT pLKO_005 1206 CDS 100% 13.200 9.240 N Dcp1b n/a
6 TRCN0000226169 TATCTTTAACAGCACTATTTG pLKO_005 711 CDS 100% 13.200 9.240 N Dcp1b n/a
7 TRCN0000253084 ACTTCTTAAGCATAATCTATG pLKO_005 1710 CDS 100% 10.800 7.560 N Dcp1b n/a
8 TRCN0000435954 ATAATCTATGAAGCCTATCTC pLKO_005 1721 CDS 100% 4.950 3.465 N DCP1B n/a
9 TRCN0000107676 CCTTTCCTTCTCTACAGAAAT pLKO.1 332 CDS 100% 13.200 7.920 N DCP1B n/a
10 TRCN0000004095 ACATGAGAGCAAAGACTAAAT pLKO.1 1784 3UTR 100% 13.200 9.240 N RWDD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033379.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.