Transcript: Mouse NM_001033385.3

Mus musculus TBC1 domain family, member 32 (Tbc1d32), mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d32 (544696)
Length:
7269
CDS:
58..3948

Additional Resources:

NCBI RefSeq record:
NM_001033385.3
NBCI Gene record:
Tbc1d32 (544696)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269190 TCCACGAAGTGCTGATCTAAA pLKO_005 2922 CDS 100% 13.200 18.480 N Tbc1d32 n/a
2 TRCN0000283974 TACCCTCTCACCGTTACATAT pLKO_005 771 CDS 100% 0.000 0.000 N Tbc1d32 n/a
3 TRCN0000269295 CAATACCCAACAAGCTATTAA pLKO_005 5994 3UTR 100% 15.000 10.500 N Tbc1d32 n/a
4 TRCN0000269294 CATGTTCTCGTAAGGATTAAT pLKO_005 2782 CDS 100% 15.000 10.500 N Tbc1d32 n/a
5 TRCN0000269356 CCACATGCATCATCGATATAA pLKO_005 2519 CDS 100% 15.000 10.500 N Tbc1d32 n/a
6 TRCN0000148846 CCATATCCTTGGCCAATGTTT pLKO.1 2863 CDS 100% 5.625 3.938 N TBC1D32 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.