Transcript: Mouse NM_001033420.2

Mus musculus dedicator of cytokinesis 1 (Dock1), mRNA.

Source:
NCBI, updated 2017-04-16
Taxon:
Mus musculus (mouse)
Gene:
Dock1 (330662)
Length:
6815
CDS:
113..5710

Additional Resources:

NCBI RefSeq record:
NM_001033420.2
NBCI Gene record:
Dock1 (330662)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252176 ATCTACACTACGGCCTATAAA pLKO_005 4499 CDS 100% 15.000 21.000 N Dock1 n/a
2 TRCN0000252177 ACGGCGTAGAGACACCATTAT pLKO_005 6332 3UTR 100% 13.200 18.480 N Dock1 n/a
3 TRCN0000258207 AGCGATTGGAGCACGTGATTT pLKO_005 1491 CDS 100% 13.200 18.480 N Dock1 n/a
4 TRCN0000252178 CCGAGTACAAATCGGTGATTT pLKO_005 1539 CDS 100% 13.200 18.480 N Dock1 n/a
5 TRCN0000252175 CTAGACTTACCTCCGAGATTT pLKO_005 4343 CDS 100% 13.200 9.240 N Dock1 n/a
6 TRCN0000029078 CCAGACAATGAATTTGCGAAT pLKO.1 4460 CDS 100% 4.050 2.835 N DOCK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.