Transcript: Mouse NM_001033437.2

Mus musculus leucine-rich single-pass membrane protein 1 (Lsmem1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Lsmem1 (380755)
Length:
1213
CDS:
115..501

Additional Resources:

NCBI RefSeq record:
NM_001033437.2
NBCI Gene record:
Lsmem1 (380755)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341399 GTGCACATACTATCCATTATA pLKO_005 581 3UTR 100% 15.000 21.000 N Lsmem1 n/a
2 TRCN0000341331 TACGTTGTGGATTCCATAAAT pLKO_005 172 CDS 100% 15.000 10.500 N Lsmem1 n/a
3 TRCN0000341334 GATGGAATCACAACATCTATT pLKO_005 219 CDS 100% 13.200 9.240 N Lsmem1 n/a
4 TRCN0000341400 GACTCTGAACAGAACTGAAAG pLKO_005 484 CDS 100% 10.800 7.560 N Lsmem1 n/a
5 TRCN0000341388 TGGTCTTCTTCGCCATCTTTC pLKO_005 344 CDS 100% 10.800 7.560 N Lsmem1 n/a
6 TRCN0000167483 GTGGATTCCATAAATGACTTA pLKO.1 178 CDS 100% 4.950 3.465 N LSMEM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033437.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.