Transcript: Mouse NM_001033466.3

Mus musculus zinc finger and BTB domain containing 2 (Zbtb2), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Zbtb2 (381990)
Length:
3227
CDS:
277..1821

Additional Resources:

NCBI RefSeq record:
NM_001033466.3
NBCI Gene record:
Zbtb2 (381990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033466.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021919 CCCAGGTGAATCGGACAAATA pLKO.1 830 CDS 100% 13.200 18.480 N ZBTB2 n/a
2 TRCN0000226173 GCCCAGGTGAATCGGACAAAT pLKO_005 829 CDS 100% 13.200 18.480 N Zbtb2 n/a
3 TRCN0000226172 GGCTAGAGCAAGGGATCAAAT pLKO_005 557 CDS 100% 13.200 10.560 N Zbtb2 n/a
4 TRCN0000226171 TAAACGCTCAGCGAGAGTTTG pLKO_005 317 CDS 100% 10.800 8.640 N Zbtb2 n/a
5 TRCN0000423061 TAAACGCTCAGCGAGAGTTTG pLKO_005 317 CDS 100% 10.800 8.640 N ZBTB2 n/a
6 TRCN0000218109 CAAGCCACCAAGATGAATTTA pLKO_005 706 CDS 100% 15.000 10.500 N Zbtb2 n/a
7 TRCN0000257299 ATAATGGTCAGTAGTACTTAT pLKO_005 2011 3UTR 100% 13.200 9.240 N Zbtb2 n/a
8 TRCN0000429035 CTTCATTCTCCAATTACTTTA pLKO_005 404 CDS 100% 13.200 9.240 N ZBTB2 n/a
9 TRCN0000376295 ACTGTGTTACTAGACTGAATG pLKO_005 1804 CDS 100% 10.800 7.560 N Zbtb2 n/a
10 TRCN0000376294 CCTGTGTTAGCGTCCATCAAA pLKO_005 1771 CDS 100% 5.625 3.938 N Zbtb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033466.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.