Transcript: Mouse NM_001033485.2

Mus musculus cDNA sequence BC048644 (BC048644), mRNA.

Source:
NCBI, updated 2015-05-21
Taxon:
Mus musculus (mouse)
Gene:
BC048644 (407789)
Length:
2260
CDS:
894..1586

Additional Resources:

NCBI RefSeq record:
NM_001033485.2
NBCI Gene record:
BC048644 (407789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254479 GTTCGGGAACACCTCAAATAC pLKO_005 1009 CDS 100% 13.200 10.560 N BC048644 n/a
2 TRCN0000265558 CCCTACCATGACACCTCAATG pLKO_005 1744 3UTR 100% 10.800 7.560 N BC048644 n/a
3 TRCN0000254408 TCGGTATCCTGCTTGAGTTTG pLKO_005 1059 CDS 100% 10.800 7.560 N BC048644 n/a
4 TRCN0000265537 TGATGGTGCGCTCTTGCAATC pLKO_005 1165 CDS 100% 6.000 4.200 N BC048644 n/a
5 TRCN0000254409 AGCCTAGCATGCATGGTTGTG pLKO_005 1188 CDS 100% 4.050 2.835 N BC048644 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.