Transcript: Mouse NM_001033528.1

Mus musculus ubiquitin specific peptidase 36 (Usp36), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Usp36 (72344)
Length:
5609
CDS:
398..3694

Additional Resources:

NCBI RefSeq record:
NM_001033528.1
NBCI Gene record:
Usp36 (72344)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033528.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030831 GCGACAAGACTCTGTAATGAT pLKO.1 1801 CDS 100% 5.625 7.875 N Usp36 n/a
2 TRCN0000327323 GCGACAAGACTCTGTAATGAT pLKO_005 1801 CDS 100% 5.625 7.875 N Usp36 n/a
3 TRCN0000030829 CCTGTGATTCTCAGGGAACAA pLKO.1 2295 CDS 100% 4.950 3.465 N Usp36 n/a
4 TRCN0000327305 CCTGTGATTCTCAGGGAACAA pLKO_005 2295 CDS 100% 4.950 3.465 N Usp36 n/a
5 TRCN0000030832 GAACGCCTATATGTGTGCTAA pLKO.1 1288 CDS 100% 4.950 3.465 N Usp36 n/a
6 TRCN0000327303 GAACGCCTATATGTGTGCTAA pLKO_005 1288 CDS 100% 4.950 3.465 N Usp36 n/a
7 TRCN0000030833 GCGCTGTTGAATGGAGTAGAT pLKO.1 2342 CDS 100% 4.950 3.465 N Usp36 n/a
8 TRCN0000327302 GCGCTGTTGAATGGAGTAGAT pLKO_005 2342 CDS 100% 4.950 3.465 N Usp36 n/a
9 TRCN0000030830 GCCTGAAGTTACAGAACGGAT pLKO.1 1884 CDS 100% 2.640 1.848 N Usp36 n/a
10 TRCN0000327322 GCCTGAAGTTACAGAACGGAT pLKO_005 1884 CDS 100% 2.640 1.848 N Usp36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033528.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.