Transcript: Mouse NM_001033785.2

Mus musculus A kinase (PRKA) anchor protein 14 (Akap14), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Akap14 (434756)
Length:
1792
CDS:
85..1695

Additional Resources:

NCBI RefSeq record:
NM_001033785.2
NBCI Gene record:
Akap14 (434756)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363065 GACTGTAGTGGACGGCGTAAT pLKO_005 1230 CDS 100% 10.800 15.120 N Akap14 n/a
2 TRCN0000363007 ACTACGTGTGCCCGAGTTAAA pLKO_005 1038 CDS 100% 13.200 10.560 N Akap14 n/a
3 TRCN0000362999 GACCAGGAGAAATTCGATTTC pLKO_005 1601 CDS 100% 10.800 7.560 N Akap14 n/a
4 TRCN0000088659 GCCCGAGTTAAAGGAAATCAA pLKO.1 1047 CDS 100% 5.625 3.938 N Akap14 n/a
5 TRCN0000088662 GCCTGTTGATGTCTCTTACAT pLKO.1 1554 CDS 100% 5.625 3.938 N Akap14 n/a
6 TRCN0000088661 CCAGTAGTAGTGCCTGAAGTA pLKO.1 469 CDS 100% 4.950 3.465 N Akap14 n/a
7 TRCN0000088658 GCTGGGTGTATTATGCTGATT pLKO.1 1388 CDS 100% 4.950 3.465 N Akap14 n/a
8 TRCN0000088660 CCAAGCATGTTACAGAGCCAA pLKO.1 176 CDS 100% 2.640 1.584 N Akap14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.