Transcript: Mouse NM_001033874.2

Mus musculus adenylate kinase 8 (Ak8), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ak8 (68870)
Length:
1584
CDS:
31..1470

Additional Resources:

NCBI RefSeq record:
NM_001033874.2
NBCI Gene record:
Ak8 (68870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024650 GCCAAGAGTTACTACCAGGTT pLKO.1 337 CDS 100% 2.640 3.696 N Ak8 n/a
2 TRCN0000360718 GTGCCGAAGGTTGTGATATTA pLKO_005 199 CDS 100% 15.000 12.000 N Ak8 n/a
3 TRCN0000360717 ACTACGATCGAGCCATCATTG pLKO_005 1367 CDS 100% 10.800 8.640 N Ak8 n/a
4 TRCN0000360644 CTACCCTTCTGGCCCAGAAAT pLKO_005 884 CDS 100% 13.200 9.240 N Ak8 n/a
5 TRCN0000360719 GTGGCTCTGCAAACATCTAAA pLKO_005 255 CDS 100% 13.200 9.240 N Ak8 n/a
6 TRCN0000024652 CCAGACAGTATCATCACCAAA pLKO.1 1012 CDS 100% 4.950 3.465 N Ak8 n/a
7 TRCN0000024649 GCCCAGAAATATGGCCTTGTA pLKO.1 895 CDS 100% 4.950 3.465 N Ak8 n/a
8 TRCN0000024651 GCTGATCGAATGGAGCAACAA pLKO.1 1039 CDS 100% 4.950 3.465 N Ak8 n/a
9 TRCN0000024653 GTTTACAAGAAGATTCCCAAT pLKO.1 355 CDS 100% 4.050 2.835 N Ak8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.