Transcript: Mouse NM_001034013.2

Mus musculus acid-sensing (proton-gated) ion channel 2 (Asic2), transcript variant MDEG1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Asic2 (11418)
Length:
2643
CDS:
213..1751

Additional Resources:

NCBI RefSeq record:
NM_001034013.2
NBCI Gene record:
Asic2 (11418)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001034013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068468 GCGCTCAATTACGAGACAATT pLKO.1 1443 CDS 100% 13.200 18.480 N Asic2 n/a
2 TRCN0000422270 TGATCAAAGAGAAGCTATTAG pLKO_005 1582 CDS 100% 13.200 9.240 N ASIC2 n/a
3 TRCN0000068469 GCGTATGAAGTTGCTGCCTTA pLKO.1 1476 CDS 100% 4.050 2.835 N Asic2 n/a
4 TRCN0000068471 GCTAGTATCCTTACAATACTA pLKO.1 1536 CDS 100% 0.563 0.394 N Asic2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001034013.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.