Transcript: Mouse NM_001034858.3

Mus musculus armadillo repeat containing 2 (Armc2), mRNA.

Source:
NCBI, updated 2017-04-22
Taxon:
Mus musculus (mouse)
Gene:
Armc2 (213402)
Length:
4865
CDS:
229..2793

Additional Resources:

NCBI RefSeq record:
NM_001034858.3
NBCI Gene record:
Armc2 (213402)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001034858.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265246 ACGTCTGCAAACTGATATTTA pLKO_005 1259 CDS 100% 15.000 21.000 N Armc2 n/a
2 TRCN0000251840 CTCATCCTCTTGTCGACATTT pLKO_005 2611 CDS 100% 13.200 18.480 N Armc2 n/a
3 TRCN0000251839 AGGACTTAGTAATTCGAATTG pLKO_005 1802 CDS 100% 10.800 15.120 N Armc2 n/a
4 TRCN0000251841 CTGTGCGAGTCTTCGGAAATC pLKO_005 2276 CDS 100% 10.800 8.640 N Armc2 n/a
5 TRCN0000251838 AGAGTACACAGTTAGCTATAA pLKO_005 3998 3UTR 100% 13.200 9.240 N Armc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001034858.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.