Transcript: Mouse NM_001034860.2

Mus musculus TD and POZ domain containing 8 (Tdpoz8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Mus musculus (mouse)
Gene:
Tdpoz8 (229571)
Length:
1810
CDS:
204..938

Additional Resources:

NCBI RefSeq record:
NM_001034860.2
NBCI Gene record:
Tdpoz8 (229571)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001034860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238611 GGCATGGCTTTGAGGTAATAT pLKO_005 1615 3UTR 100% 15.000 21.000 N Tdpoz8 n/a
2 TRCN0000238609 ATAACTCAGTTTGGTTGTTTG pLKO_005 1499 3UTR 100% 10.800 7.560 N Tdpoz8 n/a
3 TRCN0000238608 CCAACAGCAACTGGGAAATAT pLKO_005 953 3UTR 100% 15.000 9.000 N Tdpoz8 n/a
4 TRCN0000238610 ACAGTCTACCTGACATCTATT pLKO_005 1121 3UTR 100% 13.200 7.920 N Tdpoz8 n/a
5 TRCN0000238607 GGATTTGCAATAGTTCTAAAT pLKO_005 1055 3UTR 100% 13.200 7.920 N Tdpoz8 n/a
6 TRCN0000239495 CTAACACCAGATGACAAATTT pLKO_005 234 CDS 100% 15.000 7.500 Y Gm5541 n/a
7 TRCN0000198137 CACAGAGCCATGAACAGAAAT pLKO.1 195 5UTR 100% 13.200 6.600 Y Tdpoz4 n/a
8 TRCN0000197560 CCATGAACAGAAATTGTGCTA pLKO.1 202 5UTR 100% 2.640 1.320 Y Tdpoz4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001034860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.