Transcript: Human NM_001035534.3

Homo sapiens niban apoptosis regulator 2 (NIBAN2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
NIBAN2 (64855)
Length:
3798
CDS:
95..2296

Additional Resources:

NCBI RefSeq record:
NM_001035534.3
NBCI Gene record:
NIBAN2 (64855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001035534.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140609 GCCCACCTGAGTCACTTTATT pLKO.1 2437 3UTR 100% 15.000 12.000 N NIBAN2 n/a
2 TRCN0000140665 CATCAACAGTGCAGGCTACAA pLKO.1 403 CDS 100% 4.950 3.960 N NIBAN2 n/a
3 TRCN0000121861 GAACTGACATGGACCAAATTA pLKO.1 972 CDS 100% 15.000 10.500 N NIBAN2 n/a
4 TRCN0000143654 CAAATGGACAATGCCGTGTAT pLKO.1 1373 CDS 100% 4.950 3.465 N NIBAN2 n/a
5 TRCN0000140763 GAGCTGATCTTCGAGGACTTT pLKO.1 1616 CDS 100% 4.950 3.465 N NIBAN2 n/a
6 TRCN0000122833 GCAGAGCTGCTATGAGAAGAT pLKO.1 1261 CDS 100% 4.950 3.465 N NIBAN2 n/a
7 TRCN0000140112 GCAAATGGACAATGCCGTGTA pLKO.1 1372 CDS 100% 4.050 2.835 N NIBAN2 n/a
8 TRCN0000143061 CCAAATTATCACCTCCAAGGA pLKO.1 985 CDS 100% 2.640 1.848 N NIBAN2 n/a
9 TRCN0000139870 GTCCCTTCTTTGGATGTCCTT pLKO.1 3337 3UTR 100% 2.640 1.848 N NIBAN2 n/a
10 TRCN0000139156 CACTGCAACAATGGAATCCCT pLKO.1 632 CDS 100% 0.750 0.525 N NIBAN2 n/a
11 TRCN0000264737 TGCTGAAGAAATACGACTATG pLKO_005 1482 CDS 100% 10.800 7.560 N Fam129b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001035534.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.