Transcript: Human NM_001037281.2

Homo sapiens par-6 family cell polarity regulator alpha (PARD6A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PARD6A (50855)
Length:
1244
CDS:
80..1117

Additional Resources:

NCBI RefSeq record:
NM_001037281.2
NBCI Gene record:
PARD6A (50855)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001037281.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123140 TCAGTCATAGACGTGGACCTA pLKO.1 506 CDS 100% 2.640 3.696 N PARD6A n/a
2 TRCN0000299030 TCAGTCATAGACGTGGACCTA pLKO_005 506 CDS 100% 2.640 3.696 N PARD6A n/a
3 TRCN0000294798 GTCGAGGTGAAGAGCAAATTT pLKO_005 125 CDS 100% 15.000 10.500 N Pard6a n/a
4 TRCN0000123139 CGTCGAGGTGAAGAGCAAATT pLKO.1 124 CDS 100% 13.200 9.240 N PARD6A n/a
5 TRCN0000299031 CGTCGAGGTGAAGAGCAAATT pLKO_005 124 CDS 100% 13.200 9.240 N PARD6A n/a
6 TRCN0000123141 TGGACGTGCTACTTGGCTATA pLKO.1 243 CDS 100% 10.800 7.560 N PARD6A n/a
7 TRCN0000310372 TGGACGTGCTACTTGGCTATA pLKO_005 243 CDS 100% 10.800 7.560 N PARD6A n/a
8 TRCN0000123143 CCATAACCTCATTGTCACTGT pLKO.1 793 CDS 100% 2.640 1.848 N PARD6A n/a
9 TRCN0000299029 CCATAACCTCATTGTCACTGT pLKO_005 793 CDS 100% 2.640 1.848 N PARD6A n/a
10 TRCN0000123142 GCTGAGCCTGATAGTGACGAT pLKO.1 896 CDS 100% 2.640 1.848 N PARD6A n/a
11 TRCN0000299032 GCTGAGCCTGATAGTGACGAT pLKO_005 896 CDS 100% 2.640 1.848 N PARD6A n/a
12 TRCN0000113079 GCGGTCAGTGATGAGATCCTT pLKO.1 704 CDS 100% 3.000 2.100 N Pard6a n/a
13 TRCN0000298329 GCGGTCAGTGATGAGATCCTT pLKO_005 704 CDS 100% 3.000 2.100 N Pard6a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037281.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.