Transcript: Human NM_001037335.2

Homo sapiens helicase with zinc finger 2 (HELZ2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
HELZ2 (85441)
Length:
10002
CDS:
893..8842

Additional Resources:

NCBI RefSeq record:
NM_001037335.2
NBCI Gene record:
HELZ2 (85441)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001037335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060946 CCCTTACTCGTCGGAAATCAA pLKO.1 7768 CDS 100% 5.625 7.875 N HELZ2 n/a
2 TRCN0000060947 CACATCGTATTCTGGTTTCAT pLKO.1 7448 CDS 100% 5.625 3.938 N HELZ2 n/a
3 TRCN0000060945 GACATCTACATCCGGGAGTAT pLKO.1 2630 CDS 100% 4.950 3.465 N HELZ2 n/a
4 TRCN0000060944 GCTCAAGAAGTTTCTGGGCTT pLKO.1 8632 CDS 100% 2.160 1.512 N HELZ2 n/a
5 TRCN0000060943 CCACCTGTAATCACTCTGGAT pLKO.1 9175 3UTR 100% 2.640 1.584 N HELZ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.