Transcript: Human NM_001037540.3

Homo sapiens Scm polycomb group protein like 1 (SCML1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
SCML1 (6322)
Length:
2887
CDS:
305..1294

Additional Resources:

NCBI RefSeq record:
NM_001037540.3
NBCI Gene record:
SCML1 (6322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001037540.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017500 GCATAATTGTCAGCCGTATTA pLKO.1 871 CDS 100% 13.200 18.480 N SCML1 n/a
2 TRCN0000280364 GCATAATTGTCAGCCGTATTA pLKO_005 871 CDS 100% 13.200 18.480 N SCML1 n/a
3 TRCN0000017499 GCTACTACATTGACCGACTTA pLKO.1 1248 CDS 100% 4.950 6.930 N SCML1 n/a
4 TRCN0000280418 GCTACTACATTGACCGACTTA pLKO_005 1248 CDS 100% 4.950 6.930 N SCML1 n/a
5 TRCN0000017502 GCATCCACAACACTTACTCAA pLKO.1 957 CDS 100% 4.950 3.960 N SCML1 n/a
6 TRCN0000280365 GCATCCACAACACTTACTCAA pLKO_005 957 CDS 100% 4.950 3.960 N SCML1 n/a
7 TRCN0000017501 CCTCTTCAGAAGCCATGAAAT pLKO.1 1144 CDS 100% 13.200 9.240 N SCML1 n/a
8 TRCN0000017498 GCCTTCTTAGTGTGGAATCAT pLKO.1 1344 3UTR 100% 5.625 3.938 N SCML1 n/a
9 TRCN0000280363 GCCTTCTTAGTGTGGAATCAT pLKO_005 1344 3UTR 100% 5.625 3.938 N SCML1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037540.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.