Transcript: Human NM_001037804.1

Homo sapiens defensin beta 130A (DEFB130A), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
DEFB130A (245940)
Length:
240
CDS:
1..240

Additional Resources:

NCBI RefSeq record:
NM_001037804.1
NBCI Gene record:
DEFB130A (245940)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001037804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255807 TAGATGATACCATTGGTATAT pLKO_005 137 CDS 100% 13.200 6.600 Y DEFB130A n/a
2 TRCN0000255805 GGTGTGCAGAGACAAACTATG pLKO_005 108 CDS 100% 10.800 5.400 Y DEFB130A n/a
3 TRCN0000255803 CTGGCGTTATTCCAGGACAAA pLKO_005 65 CDS 100% 4.950 2.475 Y DEFB130A n/a
4 TRCN0000255806 TAGAAGGTGGTGGATACTTGA pLKO_005 180 CDS 100% 4.950 2.475 Y DEFB130A n/a
5 TRCN0000255804 TATCCAACTCCGGTTCCCAAA pLKO_005 205 CDS 100% 4.050 2.025 Y DEFB130A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.