Transcript: Mouse NM_001037809.5

Mus musculus cadherin 3 (Cdh3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Cdh3 (12560)
Length:
4037
CDS:
108..2576

Additional Resources:

NCBI RefSeq record:
NM_001037809.5
NBCI Gene record:
Cdh3 (12560)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001037809.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094415 CGCGAGACAATGTCTTCTATT pLKO.1 2167 CDS 100% 13.200 18.480 N Cdh3 n/a
2 TRCN0000414210 TTGTCAAGTACGAGCTTTATG pLKO_005 616 CDS 100% 13.200 18.480 N Cdh3 n/a
3 TRCN0000446352 GTGGGTGATGCCACCAATATT pLKO_005 407 CDS 100% 15.000 12.000 N Cdh3 n/a
4 TRCN0000094418 CCGCATCTTAAGGAGACGAAA pLKO.1 380 CDS 100% 4.950 3.960 N Cdh3 n/a
5 TRCN0000094416 CGGGAACCATTAGCGTCATAT pLKO.1 910 CDS 100% 13.200 9.240 N Cdh3 n/a
6 TRCN0000430304 CACGTATGACTTGCATCTTTC pLKO_005 1922 CDS 100% 10.800 7.560 N Cdh3 n/a
7 TRCN0000437708 GGAACTGGTCTGCATCTATAC pLKO_005 1451 CDS 100% 10.800 7.560 N Cdh3 n/a
8 TRCN0000094417 CCCAGATGAAATCGGGAACTT pLKO.1 2336 CDS 100% 4.950 3.465 N Cdh3 n/a
9 TRCN0000094414 CCTGGTACATTTCTCTGACAT pLKO.1 3054 3UTR 100% 4.950 3.465 N Cdh3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037809.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.