Transcript: Mouse NM_001037863.1

Mus musculus ATPase, class VI, type 11C (Atp11c), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Atp11c (320940)
Length:
6070
CDS:
151..3540

Additional Resources:

NCBI RefSeq record:
NM_001037863.1
NBCI Gene record:
Atp11c (320940)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001037863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101854 CCTGAGATTCTCCTAATAGTT pLKO.1 3388 CDS 100% 5.625 7.875 N Atp11c n/a
2 TRCN0000101853 CGTAAGAAGTTGCTGCATGAA pLKO.1 2317 CDS 100% 4.950 6.930 N Atp11c n/a
3 TRCN0000101851 GCCTATGTTATTGTCCTACAA pLKO.1 3561 3UTR 100% 4.950 6.930 N Atp11c n/a
4 TRCN0000101852 GCTTTGAACTACCAAGGGAAA pLKO.1 961 CDS 100% 4.050 5.670 N Atp11c n/a
5 TRCN0000449216 TTCTGGAACAGAACCTTATAT pLKO_005 237 CDS 100% 15.000 10.500 N Atp11c n/a
6 TRCN0000446594 AGTTATTGTAAGTAGCCATTA pLKO_005 3741 3UTR 100% 10.800 7.560 N Atp11c n/a
7 TRCN0000101850 CCAGGGTACATAGCCATCAAA pLKO.1 1862 CDS 100% 5.625 3.938 N Atp11c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001037863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.