Transcript: Mouse NM_001038651.3

Mus musculus zinc finger protein 953 (Zfp953), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Zfp953 (629016)
Length:
4641
CDS:
64..978

Additional Resources:

NCBI RefSeq record:
NM_001038651.3
NBCI Gene record:
Zfp953 (629016)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001038651.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240016 TCAGATCTCTTTGACATATAG pLKO_005 3846 3UTR 100% 13.200 18.480 N Zfp953 n/a
2 TRCN0000240018 CCACTCTTCACCATCACTTTA pLKO_005 669 CDS 100% 13.200 9.240 N Zfp953 n/a
3 TRCN0000240015 GAACACAAGTTAATGCATAAA pLKO_005 859 CDS 100% 13.200 9.240 N Zfp953 n/a
4 TRCN0000240017 AGTCAAGCAGACATCTCTATG pLKO_005 265 CDS 100% 10.800 7.560 N Zfp953 n/a
5 TRCN0000240014 TGTGGCAAGGCCTTCGAATAT pLKO_005 907 CDS 100% 13.200 6.600 Y Zfp953 n/a
6 TRCN0000096046 CAAATACAAGAGCCTTCAGAT pLKO.1 238 CDS 100% 4.950 2.475 Y Zfp738 n/a
7 TRCN0000126027 GAGAATCCCTACAAGTGTGAA pLKO.1 1234 3UTR 100% 4.950 2.475 Y Zfp748 n/a
8 TRCN0000096048 TGGAGCAAATACAAGAGCCTT pLKO.1 233 CDS 100% 2.640 1.320 Y Zfp738 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001038651.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.