Transcript: Mouse NM_001038846.1

Mus musculus RCSD domain containing 1 (Rcsd1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Rcsd1 (226594)
Length:
2580
CDS:
199..1347

Additional Resources:

NCBI RefSeq record:
NM_001038846.1
NBCI Gene record:
Rcsd1 (226594)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001038846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088825 TGCGGACTAGAGGCTCAATAA pLKO.1 584 CDS 100% 13.200 18.480 N Rcsd1 n/a
2 TRCN0000304686 ATCGCAGAGCCGGATACAAAG pLKO_005 1192 CDS 100% 10.800 8.640 N Rcsd1 n/a
3 TRCN0000088824 GCGGACTAGAGGCTCAATAAA pLKO.1 585 CDS 100% 15.000 10.500 N Rcsd1 n/a
4 TRCN0000311116 AGAAGCTTCAGGCCAACTTAG pLKO_005 368 CDS 100% 10.800 7.560 N Rcsd1 n/a
5 TRCN0000311119 AGGCCATCGTATCACCATTTC pLKO_005 443 CDS 100% 10.800 7.560 N Rcsd1 n/a
6 TRCN0000088823 CCTTGGAAACAGCAGCAGTAA pLKO.1 1391 3UTR 100% 4.950 2.970 N Rcsd1 n/a
7 TRCN0000331811 CCTTGGAAACAGCAGCAGTAA pLKO_005 1391 3UTR 100% 4.950 2.970 N Rcsd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001038846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.