Transcript: Mouse NM_001038996.2

Mus musculus trypsin 10 (Try10), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Try10 (436522)
Length:
890
CDS:
88..828

Additional Resources:

NCBI RefSeq record:
NM_001038996.2
NBCI Gene record:
Try10 (436522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001038996.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092384 ACCAAGAACATGATCTGTGTT pLKO.1 625 CDS 100% 4.950 2.970 N Try10 n/a
2 TRCN0000092385 TCCTGGAAAGATCACCAAGAA pLKO.1 612 CDS 100% 4.950 2.970 N Try10 n/a
3 TRCN0000092383 GCTGCCAACATCATCAAGCAT pLKO.1 355 CDS 100% 3.000 1.800 N Try10 n/a
4 TRCN0000092386 TGGAGGGCAATGAGCAGTTTA pLKO.1 329 CDS 100% 13.200 6.600 Y Try10 n/a
5 TRCN0000031916 CCCTGTGGATGATGATGACAA pLKO.1 135 CDS 100% 4.950 2.475 Y Try4 n/a
6 TRCN0000183953 CCCTGTGGATGATGATGACAA pLKO.1 135 CDS 100% 4.950 2.475 Y Try5 n/a
7 TRCN0000092387 GCTTTCCCTGTGGATGATGAT pLKO.1 130 CDS 100% 4.950 2.475 Y Try10 n/a
8 TRCN0000031971 CCGAGAGAATTCTGTTCCCTA pLKO.1 177 CDS 100% 0.000 0.000 Y Prss1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001038996.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.