Transcript: Mouse NM_001039151.1

Mus musculus CD44 antigen (Cd44), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Cd44 (12505)
Length:
4409
CDS:
320..1417

Additional Resources:

NCBI RefSeq record:
NM_001039151.1
NBCI Gene record:
Cd44 (12505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262944 GGACCGGTTACCATAACTATT pLKO_005 755 CDS 100% 13.200 18.480 N Cd44 n/a
2 TRCN0000262945 GTGTAGTGCCTACGCCATTAA pLKO_005 1412 CDS 100% 13.200 18.480 N Cd44 n/a
3 TRCN0000262947 ACAGCAAGAAGGGCGAGTATA pLKO_005 798 CDS 100% 13.200 10.560 N Cd44 n/a
4 TRCN0000065355 CCTCCCACTATGACACATATT pLKO.1 666 CDS 100% 13.200 10.560 N Cd44 n/a
5 TRCN0000262948 CCAACCACACAGGAGTATATA pLKO_005 627 CDS 100% 15.000 10.500 N Cd44 n/a
6 TRCN0000262946 GATACCTTCATGTCCATATTT pLKO_005 3716 3UTR 100% 15.000 10.500 N Cd44 n/a
7 TRCN0000065357 CCGAATTAGCTGGACACTCAA pLKO.1 1050 CDS 100% 4.950 3.465 N Cd44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039151.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.