Transcript: Mouse NM_001039494.2

Mus musculus cation channel sperm associated auxiliary subunit zeta (Catsperz), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Catsperz (67077)
Length:
781
CDS:
72..656

Additional Resources:

NCBI RefSeq record:
NM_001039494.2
NBCI Gene record:
Catsperz (67077)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039494.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176892 GAATCACTAATATTCAGCCTA pLKO.1 417 CDS 100% 2.640 3.696 N Catsperz n/a
2 TRCN0000177175 GAGACTGAAGTTCTGGATATT pLKO.1 507 CDS 100% 13.200 9.240 N Catsperz n/a
3 TRCN0000177240 GTCTACTTCAGAATCACTAAT pLKO.1 407 CDS 100% 13.200 9.240 N Catsperz n/a
4 TRCN0000176718 CGTCTACTTCAGAATCACTAA pLKO.1 406 CDS 100% 4.950 3.465 N Catsperz n/a
5 TRCN0000197902 GAAGTTCTGGATATTCTCAAA pLKO.1 513 CDS 100% 4.950 3.465 N Catsperz n/a
6 TRCN0000198757 CGAAGAATCTGAGACCTCCTT pLKO.1 380 CDS 100% 2.640 1.848 N Catsperz n/a
7 TRCN0000177941 GAAGAATCTGAGACCTCCTTA pLKO.1 381 CDS 100% 4.950 2.970 N Catsperz n/a
8 TRCN0000177604 CAAATCTGTAAGAAACAGGAT pLKO.1 233 CDS 100% 2.640 1.320 Y Catsperz n/a
9 TRCN0000176929 GCAAATCTGTAAGAAACAGGA pLKO.1 232 CDS 100% 2.640 1.320 Y Catsperz n/a
10 TRCN0000198200 CCAGACCATTTCTATTAGGGA pLKO.1 266 CDS 100% 0.750 0.375 Y Catsperz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039494.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.