Transcript: Mouse NM_001039515.1

Mus musculus ADP-ribosylation factor-like 4A (Arl4a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Arl4a (11861)
Length:
3693
CDS:
238..840

Additional Resources:

NCBI RefSeq record:
NM_001039515.1
NBCI Gene record:
Arl4a (11861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039515.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100207 CGTACCTACCAAAGGATTTAA pLKO.1 381 CDS 100% 15.000 21.000 N Arl4a n/a
2 TRCN0000325087 CGTACCTACCAAAGGATTTAA pLKO_005 381 CDS 100% 15.000 21.000 N Arl4a n/a
3 TRCN0000311432 AGTTGAACACGCTGCGATAAG pLKO_005 1300 3UTR 100% 10.800 15.120 N Arl4a n/a
4 TRCN0000305953 ATCATAGGAGATGGGCTAAAG pLKO_005 745 CDS 100% 10.800 15.120 N Arl4a n/a
5 TRCN0000305954 CCCGATGCACAGATGGTATTG pLKO_005 506 CDS 100% 10.800 15.120 N Arl4a n/a
6 TRCN0000100209 TGCAGTTCAACGAATTTGTAA pLKO.1 356 CDS 100% 5.625 4.500 N Arl4a n/a
7 TRCN0000325088 TGCAGTTCAACGAATTTGTAA pLKO_005 356 CDS 100% 5.625 4.500 N Arl4a n/a
8 TRCN0000100206 CCTGTGCTTATAGTTGCTAAT pLKO.1 619 CDS 100% 10.800 7.560 N Arl4a n/a
9 TRCN0000381358 GGTTTGGACTGTGCTGGAAAG pLKO_005 316 CDS 100% 6.000 4.200 N ARL4A n/a
10 TRCN0000100208 CGAGAAACTACATGATATGAT pLKO.1 774 CDS 100% 5.625 3.938 N Arl4a n/a
11 TRCN0000100205 GCGCACTATTACTTGAACCTA pLKO.1 1594 3UTR 100% 3.000 2.100 N Arl4a n/a
12 TRCN0000380147 TATACAGGCTGCAGTTCAATG pLKO_005 347 CDS 100% 10.800 7.560 N ARL4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039515.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.