Transcript: Mouse NM_001039536.2

Mus musculus phosphatidylinositol glycan anchor biosynthesis, class L (Pigl), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Pigl (327942)
Length:
1657
CDS:
1..759

Additional Resources:

NCBI RefSeq record:
NM_001039536.2
NBCI Gene record:
Pigl (327942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001039536.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093742 CAACCATATTGCTTTGTACAA pLKO.1 465 CDS 100% 4.950 3.960 N Pigl n/a
2 TRCN0000093740 CCGTGTAATGATTATTGACAA pLKO.1 312 CDS 100% 4.950 3.960 N Pigl n/a
3 TRCN0000093741 CAGCAACCATATTGCTTTGTA pLKO.1 462 CDS 100% 0.563 0.394 N Pigl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039536.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.