Transcript: Human NM_001039580.2

Homo sapiens microtubule associated protein 9 (MAP9), mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
MAP9 (79884)
Length:
7328
CDS:
260..2203

Additional Resources:

NCBI RefSeq record:
NM_001039580.2
NBCI Gene record:
MAP9 (79884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000128630 CAGTTGATCCACTACTATCTA pLKO.1 1242 CDS 100% 5.625 3.938 N MAP9 n/a
2 TRCN0000128631 CTGAGGATTCATGCTTAACAA pLKO.1 963 CDS 100% 5.625 3.938 N MAP9 n/a
3 TRCN0000128268 GAGAAGAAGCATTAGCATCAT pLKO.1 1656 CDS 100% 4.950 3.465 N MAP9 n/a
4 TRCN0000130819 GAGGAGAAGGATGGACTAGAA pLKO.1 824 CDS 100% 4.950 3.465 N MAP9 n/a
5 TRCN0000129633 CTGATGACCTTGAAGAAGAAA pLKO.1 1185 CDS 100% 5.625 3.375 N MAP9 n/a
6 TRCN0000128060 GCCAGACAAAGGAGTTCTGAA pLKO.1 368 CDS 100% 4.950 2.970 N MAP9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039580.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.