Transcript: Human NM_001039670.3

Homo sapiens intermediate filament family orphan 1 (IFFO1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
IFFO1 (25900)
Length:
3227
CDS:
14..1705

Additional Resources:

NCBI RefSeq record:
NM_001039670.3
NBCI Gene record:
IFFO1 (25900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039670.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117097 CCGTGCTTTAAAGAGGCCTTA pLKO.1 2313 3UTR 100% 4.050 2.835 N IFFO1 n/a
2 TRCN0000117098 CTCCAACATCAACGTGCTCAA pLKO.1 226 CDS 100% 4.050 2.835 N IFFO1 n/a
3 TRCN0000195906 CATTGACCAGATAGAGCTGGA pLKO.1 1453 CDS 100% 2.160 1.512 N Iffo1 n/a
4 TRCN0000117100 GCCCGAGATCCGCGCTCTCTA pLKO.1 718 CDS 100% 0.000 0.000 N IFFO1 n/a
5 TRCN0000117101 GCCTGGCTTGTCGTGGGTGCA pLKO.1 661 CDS 100% 0.000 0.000 N IFFO1 n/a
6 TRCN0000339598 CCAGCTGAGGGAGTATGATTT pLKO_005 1246 CDS 100% 13.200 7.920 N Iffo1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039670.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.