Transcript: Human NM_001039690.5

Homo sapiens chromosome transmission fidelity factor 8 (CHTF8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CHTF8 (54921)
Length:
2921
CDS:
141..506

Additional Resources:

NCBI RefSeq record:
NM_001039690.5
NBCI Gene record:
CHTF8 (54921)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001039690.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283057 CCTCCTGGGAGACCTACATTA pLKO_005 251 CDS 100% 13.200 6.600 Y Chtf8 n/a
2 TRCN0000178758 CAAATCCATCTCCCATGTCAA pLKO.1 1488 3UTR 100% 4.950 2.475 Y CHTF8 n/a
3 TRCN0000179148 GTTCTGTTAACCTCTGGGAAT pLKO.1 1067 3UTR 100% 4.050 2.025 Y CHTF8 n/a
4 TRCN0000180128 CAGCTTCTTTCTCACAGGCTT pLKO.1 1368 3UTR 100% 2.640 1.320 Y CHTF8 n/a
5 TRCN0000179434 GCTCAAGTTCAAATGAGCCAT pLKO.1 2190 3UTR 100% 0.264 0.132 Y CHTF8 n/a
6 TRCN0000183356 GCCCATTGTTTCTTACTAGTT pLKO.1 2354 3UTR 100% 0.000 0.000 Y CHTF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001039690.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.