Transcript: Human NM_001042466.3

Homo sapiens prosaposin (PSAP), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PSAP (5660)
Length:
2754
CDS:
31..1611

Additional Resources:

NCBI RefSeq record:
NM_001042466.3
NBCI Gene record:
PSAP (5660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042466.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230343 ACTGTAATAGCATAGGGATTT pLKO_005 2146 3UTR 100% 10.800 15.120 N PSAP n/a
2 TRCN0000217974 GAACTATATCAGCCAGTATTC pLKO_005 756 CDS 100% 10.800 15.120 N PSAP n/a
3 TRCN0000083793 CCACTGTAATAGCATAGGGAT pLKO.1 2144 3UTR 100% 2.640 2.112 N PSAP n/a
4 TRCN0000083796 CGACATATGCAAGAACTATAT pLKO.1 744 CDS 100% 0.000 0.000 N PSAP n/a
5 TRCN0000230342 GAACTGGTGGAGCCCATTAAG pLKO_005 925 CDS 100% 13.200 9.240 N PSAP n/a
6 TRCN0000230341 GAAGCAGCTGGAGTCCAATAA pLKO_005 483 CDS 100% 13.200 9.240 N PSAP n/a
7 TRCN0000083795 CCTTACCAGAAGCAGTGTGAT pLKO.1 1372 CDS 100% 4.950 3.465 N PSAP n/a
8 TRCN0000083797 GTCTGCTTCATGCAAGGAGAT pLKO.1 336 CDS 100% 4.050 2.835 N PSAP n/a
9 TRCN0000083794 GCCAGTATTCTGAAATTGCTA pLKO.1 767 CDS 100% 3.000 2.100 N PSAP n/a
10 TRCN0000230340 CTGTCATCCTGGACATCATTA pLKO_005 374 CDS 100% 13.200 7.920 N PSAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042466.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.