Transcript: Human NM_001042478.2

Homo sapiens adherens junctions associated protein 1 (AJAP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
AJAP1 (55966)
Length:
2507
CDS:
818..2053

Additional Resources:

NCBI RefSeq record:
NM_001042478.2
NBCI Gene record:
AJAP1 (55966)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042478.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426455 GGGAGTACAAATCCACATTTA pLKO_005 1950 CDS 100% 13.200 18.480 N AJAP1 n/a
2 TRCN0000107054 TGGATACTGATAGCCATGTTT pLKO.1 893 CDS 100% 5.625 7.875 N AJAP1 n/a
3 TRCN0000429978 GGACATATTCACGGCCTATAA pLKO_005 1849 CDS 100% 13.200 9.240 N AJAP1 n/a
4 TRCN0000107053 TCATCACAACTCTTGTCTTAA pLKO.1 1707 CDS 100% 13.200 9.240 N AJAP1 n/a
5 TRCN0000253236 TCATCACAACTCTTGTCTTAA pLKO_005 1707 CDS 100% 13.200 9.240 N Ajap1 n/a
6 TRCN0000253237 GCCATGCCTGGATACTGATAG pLKO_005 885 CDS 100% 10.800 7.560 N Ajap1 n/a
7 TRCN0000107052 GCTGCTCTCATCACAACTCTT pLKO.1 1700 CDS 100% 4.950 3.465 N AJAP1 n/a
8 TRCN0000107051 CCTCTTCTGATCGGCATCTTA pLKO.1 1986 CDS 100% 5.625 3.375 N AJAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042478.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.