Transcript: Human NM_001042522.2

Homo sapiens sprouty related EVH1 domain containing 3 (SPRED3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
SPRED3 (399473)
Length:
5075
CDS:
104..1336

Additional Resources:

NCBI RefSeq record:
NM_001042522.2
NBCI Gene record:
SPRED3 (399473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256127 ACAACCTTGGAGTGTACACTG pLKO_005 281 CDS 100% 4.050 5.670 N SPRED3 n/a
2 TRCN0000256130 TGGTTTACAACAAGGTGAATC pLKO_005 312 CDS 100% 10.800 7.560 N SPRED3 n/a
3 TRCN0000256128 CAAGTTTGGACTGACGTTTCA pLKO_005 364 CDS 100% 4.950 3.465 N SPRED3 n/a
4 TRCN0000256131 GGCTGATGAGTTCCAGAAGAG pLKO_005 397 CDS 100% 4.050 2.835 N SPRED3 n/a
5 TRCN0000256129 ATCTTTCACCACTGGAGCCTG pLKO_005 335 CDS 100% 2.160 1.512 N SPRED3 n/a
6 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3613 3UTR 100% 4.950 2.475 Y n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3684 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3684 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.