Transcript: Human NM_001042545.2

Homo sapiens latent transforming growth factor beta binding protein 4 (LTBP4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LTBP4 (8425)
Length:
4961
CDS:
20..4693

Additional Resources:

NCBI RefSeq record:
NM_001042545.2
NBCI Gene record:
LTBP4 (8425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042545.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445034 CAACATCCTGGCTCGGAATGT pLKO_005 3400 CDS 100% 4.950 6.930 N LTBP4 n/a
2 TRCN0000055829 CAACCGGCTTTGAAAGAGTTA pLKO.1 852 CDS 100% 4.950 6.930 N LTBP4 n/a
3 TRCN0000055831 CGTGGACGAATGTCAGCTCTT pLKO.1 3577 CDS 100% 4.050 3.240 N LTBP4 n/a
4 TRCN0000438763 GCTTCGACATGCCAGACTTTG pLKO_005 4227 CDS 100% 10.800 7.560 N LTBP4 n/a
5 TRCN0000418428 TGAAACACTACAGGGTGTATG pLKO_005 3103 CDS 100% 10.800 7.560 N LTBP4 n/a
6 TRCN0000436932 TGCCCATTCTGCGGAACATCA pLKO_005 1077 CDS 100% 4.950 3.465 N LTBP4 n/a
7 TRCN0000055828 CGATGCATTGATGTGGACGAA pLKO.1 1568 CDS 100% 2.640 1.848 N LTBP4 n/a
8 TRCN0000055830 CCCAGACTTAGGTCCACCTTA pLKO.1 4093 CDS 100% 4.950 2.970 N LTBP4 n/a
9 TRCN0000055832 TGTCCCTTGATCTGTCACAAT pLKO.1 275 CDS 100% 4.950 2.970 N LTBP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042545.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.