Transcript: Human NM_001042576.1

Homo sapiens ribosome binding protein 1 (RRBP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
RRBP1 (6238)
Length:
3792
CDS:
355..3288

Additional Resources:

NCBI RefSeq record:
NM_001042576.1
NBCI Gene record:
RRBP1 (6238)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042576.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303707 ACGTAGAGGATGGTGACATAG pLKO_005 2846 CDS 100% 10.800 8.640 N RRBP1 n/a
2 TRCN0000117411 GCATGTCGGTTACAAGAAGAA pLKO.1 3019 CDS 100% 4.950 3.960 N RRBP1 n/a
3 TRCN0000303749 CAGGCAGCAGTTGAGTGAAAT pLKO_005 2817 CDS 100% 13.200 9.240 N RRBP1 n/a
4 TRCN0000303641 ACCAACCTACACAGCGTTATC pLKO_005 3361 3UTR 100% 10.800 7.560 N RRBP1 n/a
5 TRCN0000117409 CTGAGGCAACTTCTCCTAGAA pLKO.1 2731 CDS 100% 4.950 3.465 N RRBP1 n/a
6 TRCN0000117410 GCTGTCAGCTCTGTAGTGAAT pLKO.1 808 CDS 100% 4.950 3.465 N RRBP1 n/a
7 TRCN0000117408 GTGAAGCATCTCGAAGAGATT pLKO.1 2575 CDS 100% 4.950 3.465 N RRBP1 n/a
8 TRCN0000299410 GTGAAGCATCTCGAAGAGATT pLKO_005 2575 CDS 100% 4.950 3.465 N RRBP1 n/a
9 TRCN0000117407 CCTAATGGGAAGATACCTGAT pLKO.1 589 CDS 100% 4.050 2.835 N RRBP1 n/a
10 TRCN0000303642 TCCATGAAGGAAACGTCATAT pLKO_005 448 CDS 100% 13.200 7.920 N RRBP1 n/a
11 TRCN0000194406 CCTAATGGGAAGATACCTGAA pLKO.1 589 CDS 100% 4.050 2.835 N Rrbp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042576.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.