Transcript: Human NM_001042603.3

Homo sapiens lysine demethylase 5A (KDM5A), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KDM5A (5927)
Length:
10701
CDS:
230..5302

Additional Resources:

NCBI RefSeq record:
NM_001042603.3
NBCI Gene record:
KDM5A (5927)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042603.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329799 CAACAGGTCAGACGCATTTAA pLKO_005 1036 CDS 100% 15.000 21.000 N KDM5A n/a
2 TRCN0000014630 CGGACCGACATTGGTGTATAT pLKO.1 3458 CDS 100% 13.200 18.480 N KDM5A n/a
3 TRCN0000329798 CGGACCGACATTGGTGTATAT pLKO_005 3458 CDS 100% 13.200 18.480 N KDM5A n/a
4 TRCN0000329939 ACTACCAATGGAGGATCTTAA pLKO_005 5269 CDS 100% 13.200 9.240 N KDM5A n/a
5 TRCN0000014629 CCAGACTTACAGGGACACTTA pLKO.1 4148 CDS 100% 4.950 3.465 N KDM5A n/a
6 TRCN0000329872 CCAGACTTACAGGGACACTTA pLKO_005 4148 CDS 100% 4.950 3.465 N KDM5A n/a
7 TRCN0000014631 CCCATGCAGAAGAAATGTCTT pLKO.1 2357 CDS 100% 4.950 3.465 N KDM5A n/a
8 TRCN0000014632 CCTTGAAAGAAGCCTTACAAA pLKO.1 3207 CDS 100% 5.625 3.375 N KDM5A n/a
9 TRCN0000329797 CCTTGAAAGAAGCCTTACAAA pLKO_005 3207 CDS 100% 5.625 3.375 N KDM5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042603.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.