Transcript: Mouse NM_001042605.1

Mus musculus CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated) (Cd74), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Cd74 (16149)
Length:
1431
CDS:
86..925

Additional Resources:

NCBI RefSeq record:
NM_001042605.1
NBCI Gene record:
Cd74 (16149)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001042605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066088 GCGTCCAATGTCCATGGATAA pLKO.1 379 CDS 100% 10.800 15.120 N Cd74 n/a
2 TRCN0000066089 CGTTACCAAGTACGGCAACAT pLKO.1 424 CDS 100% 4.950 6.930 N Cd74 n/a
3 TRCN0000066092 CTTCGCATGAAGCTTCCGAAA pLKO.1 311 CDS 100% 4.050 5.670 N Cd74 n/a
4 TRCN0000066090 GCTCTTGTTTGAGATGAGCAA pLKO.1 595 CDS 100% 2.640 1.848 N Cd74 n/a
5 TRCN0000066091 GCTTACTTCCTGTACCAGCAA pLKO.1 236 CDS 100% 2.640 1.848 N Cd74 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.