Transcript: Mouse NM_001042620.2

Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 15 (Dhx15), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Dhx15 (13204)
Length:
3009
CDS:
197..2308

Additional Resources:

NCBI RefSeq record:
NM_001042620.2
NBCI Gene record:
Dhx15 (13204)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001042620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000009 TGTAAGAGAATAAAGCGTGAA pLKO.1 1292 CDS 100% 4.050 5.670 N DHX15 n/a
2 TRCN0000294866 GATAGAGAGGACCGATCTAAA pLKO_005 290 CDS 100% 13.200 10.560 N Dhx15 n/a
3 TRCN0000113044 CCAGCAGCTATCAAGAATTAT pLKO.1 2179 CDS 100% 15.000 10.500 N Dhx15 n/a
4 TRCN0000287370 CCAGCAGCTATCAAGAATTAT pLKO_005 2179 CDS 100% 15.000 10.500 N Dhx15 n/a
5 TRCN0000113041 GCCCTGAAGTTGGTGATATTA pLKO.1 1326 CDS 100% 15.000 10.500 N Dhx15 n/a
6 TRCN0000298335 GCCCTGAAGTTGGTGATATTA pLKO_005 1326 CDS 100% 15.000 10.500 N Dhx15 n/a
7 TRCN0000113042 GCTCCCTGTATGGGAATACAA pLKO.1 604 CDS 100% 0.563 0.394 N Dhx15 n/a
8 TRCN0000000007 ACTGTTCTAATGAGGTCCTAT pLKO.1 1941 CDS 100% 4.950 2.970 N DHX15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.