Transcript: Mouse NM_001044380.1

Mus musculus hedgehog interacting protein-like 1 (Hhipl1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Hhipl1 (214305)
Length:
2605
CDS:
142..2517

Additional Resources:

NCBI RefSeq record:
NM_001044380.1
NBCI Gene record:
Hhipl1 (214305)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001044380.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251835 CCCACACAAGCTGGGTAAATC pLKO_005 1560 CDS 100% 13.200 18.480 N Hhipl1 n/a
2 TRCN0000251836 TCGATGACGTGCTGCCGATTT pLKO_005 1532 CDS 100% 10.800 15.120 N Hhipl1 n/a
3 TRCN0000251837 CATGGCTCAGAGAGGATAATT pLKO_005 1048 CDS 100% 15.000 10.500 N Hhipl1 n/a
4 TRCN0000251834 CTGGCCTGTGTGAAGATTATT pLKO_005 482 CDS 100% 15.000 10.500 N Hhipl1 n/a
5 TRCN0000251833 ATCTCAATGGCCTCTACATTT pLKO_005 1622 CDS 100% 13.200 7.920 N Hhipl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001044380.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.