Transcript: Mouse NM_001044751.1

Mus musculus hydroxysteroid 11-beta dehydrogenase 1 (Hsd11b1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Mus musculus (mouse)
Gene:
Hsd11b1 (15483)
Length:
1355
CDS:
99..977

Additional Resources:

NCBI RefSeq record:
NM_001044751.1
NBCI Gene record:
Hsd11b1 (15483)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001044751.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041555 CACCATTAGAACAGAACTCTA pLKO.1 683 CDS 100% 4.950 3.960 N Hsd11b1 n/a
2 TRCN0000041557 GCAAGCAAGTTTGCTCTGGAT pLKO.1 651 CDS 100% 2.640 2.112 N Hsd11b1 n/a
3 TRCN0000041554 GCAAAGGGATTGGAAGAGAAA pLKO.1 226 CDS 100% 4.950 3.465 N Hsd11b1 n/a
4 TRCN0000041553 GCACTATGGAAGACATGACAT pLKO.1 370 CDS 100% 4.950 3.465 N Hsd11b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001044751.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.