Transcript: Mouse NM_001045484.2

Mus musculus myocyte enhancer factor 2B (Mef2b), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Mef2b (17259)
Length:
1339
CDS:
107..1126

Additional Resources:

NCBI RefSeq record:
NM_001045484.2
NBCI Gene record:
Mef2b (17259)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001045484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085179 GTGCTTTGTGACTGCGACATT pLKO.1 215 CDS 100% 4.950 2.475 Y Mef2b n/a
2 TRCN0000433608 CATCAAGTCTGAGCGACTGTC pLKO_005 973 CDS 100% 4.050 2.025 Y Mef2b n/a
3 TRCN0000430039 GCGGATATCCTTCAGACACTG pLKO_005 350 CDS 100% 4.050 2.025 Y Mef2b n/a
4 TRCN0000085181 GCTGCTCAAATACACCGAGTA pLKO.1 301 CDS 100% 4.050 2.025 Y Mef2b n/a
5 TRCN0000436582 TAGCTTTGCCTTCTTACCATC pLKO_005 787 CDS 100% 4.050 2.025 Y Mef2b n/a
6 TRCN0000433648 TCGGTTTCAGAGCTGTCCTAC pLKO_005 518 CDS 100% 4.050 2.025 Y Mef2b n/a
7 TRCN0000085180 CCTCTGTACCTGGCGACTGAT pLKO.1 683 CDS 100% 1.650 0.825 Y Mef2b n/a
8 TRCN0000085182 CCCTGACAGCTGGCCACGGTA pLKO.1 1105 CDS 100% 0.000 0.000 Y Mef2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001045484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.