Transcript: Mouse NM_001045514.3

Mus musculus AT-hook transcription factor (Akna), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Akna (100182)
Length:
5480
CDS:
343..4557

Additional Resources:

NCBI RefSeq record:
NM_001045514.3
NBCI Gene record:
Akna (100182)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001045514.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257344 TGGGCTCAGAAACCAGTATAG pLKO_005 3044 CDS 100% 10.800 8.640 N Akna n/a
2 TRCN0000218041 ATGTGCTTCTGCAGCTAATAA pLKO_005 4827 3UTR 100% 15.000 10.500 N Akna n/a
3 TRCN0000239437 GAGATACCTCAGCGTTAAATC pLKO_005 2580 CDS 100% 13.200 9.240 N Akna n/a
4 TRCN0000239435 ACAAGGAAGCAAGGTCTTATC pLKO_005 1776 CDS 100% 10.800 7.560 N Akna n/a
5 TRCN0000239436 CATCTCCTCAGCTCCCATTAT pLKO_005 4275 CDS 100% 13.200 7.920 N Akna n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001045514.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.