Transcript: Mouse NM_001045529.3

Mus musculus microrchidia 3 (Morc3), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Morc3 (338467)
Length:
4237
CDS:
190..3018

Additional Resources:

NCBI RefSeq record:
NM_001045529.3
NBCI Gene record:
Morc3 (338467)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001045529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321748 GTGATGTTTACCGACCTAAAT pLKO_005 1049 CDS 100% 13.200 18.480 N Morc3 n/a
2 TRCN0000321687 GCAGCGTAATAGCGAACTTAG pLKO_005 3170 3UTR 100% 10.800 15.120 N Morc3 n/a
3 TRCN0000026918 CCAGTTGGATTGTACGGGAAT pLKO.1 475 CDS 100% 4.050 5.670 N Morc3 n/a
4 TRCN0000321814 CAGTGATTAGTGACCATATAT pLKO_005 353 CDS 100% 15.000 12.000 N Morc3 n/a
5 TRCN0000363378 ACACCGTCAGATGATTAATTT pLKO_005 645 CDS 100% 15.000 10.500 N Morc3 n/a
6 TRCN0000321815 CCTTTGCAGCAAGGATTATAA pLKO_005 1754 CDS 100% 15.000 10.500 N Morc3 n/a
7 TRCN0000321749 AGCGAGATCAGCAGTACTTAA pLKO_005 2998 CDS 100% 13.200 9.240 N Morc3 n/a
8 TRCN0000378604 GATTTAGTGCATCCTACTTAT pLKO_005 1555 CDS 100% 13.200 9.240 N Morc3 n/a
9 TRCN0000026932 GCATTCATGTTGACCTTGTAA pLKO.1 2030 CDS 100% 5.625 3.938 N Morc3 n/a
10 TRCN0000026900 GCCTACATTGAACGTGATGTT pLKO.1 1036 CDS 100% 4.950 3.465 N Morc3 n/a
11 TRCN0000026930 CGCTTGTCTAAAGTGGCGAAA pLKO.1 1431 CDS 100% 4.050 2.835 N Morc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001045529.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.