Transcript: Mouse NM_001045540.2

Mus musculus predicted gene 12185 (Gm12185), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Gm12185 (620913)
Length:
5287
CDS:
279..2786

Additional Resources:

NCBI RefSeq record:
NM_001045540.2
NBCI Gene record:
Gm12185 (620913)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001045540.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270656 TTAGTCATGCTCTGCGAAATA pLKO_005 1660 CDS 100% 13.200 18.480 N Gm12185 n/a
2 TRCN0000270597 TTGTTCTCCAACTCGTTTATA pLKO_005 3176 3UTR 100% 15.000 12.000 N Gm12185 n/a
3 TRCN0000270659 ATTGAAGAGTATTCGAATTTG pLKO_005 872 CDS 100% 13.200 9.240 N Gm12185 n/a
4 TRCN0000270660 GTAACCCTATGAGATTCAATA pLKO_005 841 CDS 100% 13.200 9.240 N Gm12185 n/a
5 TRCN0000270658 TTGTCTCTGCTATACGTATTA pLKO_005 718 CDS 100% 13.200 9.240 N Gm12185 n/a
6 TRCN0000102714 CCACATGATTATCTGAAGAAA pLKO.1 666 CDS 100% 5.625 2.813 Y Gm5431 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001045540.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.