Transcript: Mouse NM_001077189.1

Mus musculus Fc receptor, IgG, low affinity IIb (Fcgr2b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Fcgr2b (14130)
Length:
1556
CDS:
69..1091

Additional Resources:

NCBI RefSeq record:
NM_001077189.1
NBCI Gene record:
Fcgr2b (14130)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001077189.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067768 CGCTAAGATAAGGAGAACAAT pLKO.1 1377 3UTR 100% 5.625 7.875 N Fcgr2b n/a
2 TRCN0000420447 CAACGTGGGAACTGCTTATAA pLKO_005 1352 3UTR 100% 15.000 12.000 N Fcgr2b n/a
3 TRCN0000435721 TAATCAACTTACTGCCGTTAA pLKO_005 1321 3UTR 100% 10.800 8.640 N Fcgr2b n/a
4 TRCN0000419846 AGGGATGCTGTAGATATTAAA pLKO_005 1152 3UTR 100% 15.000 10.500 N Fcgr2b n/a
5 TRCN0000067772 CTCACGGACTTTGTGCCATAT pLKO.1 128 CDS 100% 10.800 7.560 N Fcgr2b n/a
6 TRCN0000067771 CCAGCAGGTCTTTACCAGTAT pLKO.1 712 CDS 100% 4.950 3.465 N Fcgr2b n/a
7 TRCN0000067770 CCATGTGTTCTCACGGACTTT pLKO.1 119 CDS 100% 4.950 3.465 N Fcgr2b n/a
8 TRCN0000067769 GCCATTGTTATTATCCTAGTA pLKO.1 771 CDS 100% 4.950 3.465 N Fcgr2b n/a
9 TRCN0000029587 CAGTGGTTCCACAATGGGAAT pLKO.1 303 CDS 100% 4.050 2.835 N FCGR2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077189.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.