Transcript: Human NM_001077196.2

Homo sapiens phosphodiesterase 11A (PDE11A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
PDE11A (50940)
Length:
7801
CDS:
169..1638

Additional Resources:

NCBI RefSeq record:
NM_001077196.2
NBCI Gene record:
PDE11A (50940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077196.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431149 CATACTCCGACTGGCTAATAA pLKO_005 230 CDS 100% 15.000 21.000 N PDE11A n/a
2 TRCN0000432758 CGTGATATATTTCGATCAATG pLKO_005 1246 CDS 100% 10.800 15.120 N PDE11A n/a
3 TRCN0000421398 GCTCTTGATGTGCTATCATAC pLKO_005 565 CDS 100% 10.800 7.560 N PDE11A n/a
4 TRCN0000048926 CGGGAGAGATTAGAGCTCAAA pLKO.1 1366 CDS 100% 4.950 3.465 N PDE11A n/a
5 TRCN0000174085 CGGGAGAGATTAGAGCTCAAA pLKO.1 1366 CDS 100% 4.950 3.465 N PDE11A n/a
6 TRCN0000048923 CGCTGTACTTTGAGAGGAGAA pLKO.1 1169 CDS 100% 4.050 2.835 N PDE11A n/a
7 TRCN0000157407 GATCTCGGCTTACTGCAACTT pLKO.1 3245 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
8 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 3273 3UTR 100% 4.950 2.475 Y C16orf89 n/a
9 TRCN0000168807 GCTGATCTCAAACTCCTGATA pLKO.1 3393 3UTR 100% 4.950 2.475 Y TMEM105 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077196.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.