Transcript: Human NM_001077269.1

Homo sapiens WAS/WASL interacting protein family member 1 (WIPF1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
WIPF1 (7456)
Length:
4664
CDS:
165..1676

Additional Resources:

NCBI RefSeq record:
NM_001077269.1
NBCI Gene record:
WIPF1 (7456)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422543 GGGTGGGAATCGGTAAGAAAT pLKO_005 1821 3UTR 100% 13.200 18.480 N WIPF1 n/a
2 TRCN0000422805 GATTCTACTTCCATCCGATTT pLKO_005 1522 CDS 100% 10.800 15.120 N WIPF1 n/a
3 TRCN0000414977 CAAACTGGCAAGAAACGAAAG pLKO_005 1595 CDS 100% 6.000 8.400 N WIPF1 n/a
4 TRCN0000029826 CATTCAATCAAGTCCGCACAA pLKO.1 743 CDS 100% 4.050 5.670 N WIPF1 n/a
5 TRCN0000029827 CCTCCACCATCAACATCTATT pLKO.1 1455 CDS 100% 13.200 9.240 N WIPF1 n/a
6 TRCN0000029825 CCAATACTGGACAAACCTAAA pLKO.1 333 CDS 100% 10.800 7.560 N WIPF1 n/a
7 TRCN0000029828 CAATACAGAGAAGCCTACCTT pLKO.1 218 CDS 100% 3.000 2.100 N WIPF1 n/a
8 TRCN0000183172 GAAAGCAGATTCTACTTCCAT pLKO.1 1515 CDS 100% 3.000 2.100 N Wipf1 n/a
9 TRCN0000029824 CCATGTGAAGATGAGTGGGAA pLKO.1 1497 CDS 100% 2.640 1.848 N WIPF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.