Transcript: Mouse NM_001077421.1

Mus musculus spermine binding protein-like (Sbpl), mRNA.

Source:
NCBI, updated 2016-08-26
Taxon:
Mus musculus (mouse)
Gene:
Sbpl (638345)
Length:
876
CDS:
18..716

Additional Resources:

NCBI RefSeq record:
NM_001077421.1
NBCI Gene record:
Sbpl (638345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001077421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255330 ATCCCGGTCAGATAACTTTAT pLKO_005 266 CDS 100% 13.200 7.920 N Sbpl n/a
2 TRCN0000255326 ATAACTGGACTGATGTCTATG pLKO_005 244 CDS 100% 10.800 6.480 N Sbpl n/a
3 TRCN0000255329 AGGACGGAGAGCACGTGATAA pLKO_005 301 CDS 100% 13.200 6.600 Y Sbpl n/a
4 TRCN0000255328 CGATGATGATGACGATGATAA pLKO_005 671 CDS 100% 13.200 6.600 Y Sbpl n/a
5 TRCN0000255327 GAATGCTGCTGGCAAGTATTT pLKO_005 128 CDS 100% 13.200 6.600 Y Sbpl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077421.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.